2:33   Decode from DNA to mRNA to tRNA to amino acids 9:29   2024 FRQ 6 Explained! Protein Synthesis and the Genetic Code 0:33   Why does an organism without a large difference in the amount of DNA in its genome produce signific… 2:33   Prompt 5-2 GN311 2:45   exam video 5- point mutations 0:33   DNA: GTACGCGTATACCGACATTC mRNA: CAUGCGCAUAUGGCUgUAAG Codons: AUG-CGC-AUA-UGG-CUG-UAA Amino Acids: M… 7:50   How to Read a Codon Chart 2:17   Point Mutations in DNA 2:43   GN311 Exam Mini Video 4-1B 2:20   Kahmya Cowan GN 311 Exam 4-1B Translation and Point Mutation 3:16   DNA Mutations 2:58   GN 311 Video 4.1- Effect of Base Pair Insertion on mRNA Codons 2:54   GN 311 Effects of point mutations in DNA 0:33   The base sequence of a fragment of DNA is: ACC GTG CAG GAT. What is the base sequence on the messen…