9:29   2024 FRQ 6 Explained! Protein Synthesis and the Genetic Code 4:14   BTS: Yet to come - UGH! | Amazon Prime 0:33   DNA: GTACGCGTATACCGACATTC mRNA: CAUGCGCAUAUGGCUgUAAG Codons: AUG-CGC-AUA-UGG-CUG-UAA Amino Acids: M… 2:20   Kahmya Cowan GN 311 Exam 4-1B Translation and Point Mutation 2:43   GN311 Exam Mini Video 4-1B 2:54   GN 311 Effects of point mutations in DNA 2:13   What Lisa Guerrero Learned About Her Background When She Took the MyHeritage DNA Test 2:58   GN 311 Video 4.1- Effect of Base Pair Insertion on mRNA Codons 2:55   Exam Video 4-1B 2:46   4-1: Mutations, DNA Repair and Prokaryotic Regulation 3:00   Genetics 4-1A 2:27   Coding Mutations, Mutant Proteins 2:17   Point Mutations in DNA 2:58   GN311 Exam Mini Video 4-1B 2:37   Genetics 311 4-1B 2:33   Prompt 5-2 GN311 2:45   exam video 5- point mutations